protoscript ii first strand cdna synthesis kit (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
protoscript ii first strand cdna synthesis kit
Protoscript Ii First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1843 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/strand+cdna+synthesis/ProtoScript+II+First+Strand+cDNA+Synthesis+Kit/pmc13612924-68-4-11
Average 99 stars, based on 1843 article reviews
Protoscript Ii First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1843 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/strand+cdna+synthesis/ProtoScript+II+First+Strand+cDNA+Synthesis+Kit/pmc13612924-68-4-11
Average 99 stars, based on 1843 article reviews
protoscript ii first strand cdna synthesis kit - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
cDNA Synthesis:Article Title: Gonadotropin-Inhibitory Hormone (GnIH) Induces Glycolipid Metabolic Dysfunction in Porcine Ovarian Granulosa Cells via Wnt and AMPK Signaling Pathways. Article Snippet: Animal reproduction is closely linked to energy metabolism, and ovarian glycolipid metabolism disorders can lead to follicular abnormalities, reduced fertility, and infertility.. Granulosa cells (GCs), as key energy suppliers in the ovary, directly influence oocyte development, hormone secretion, and reproductive function.. However, the interaction between reproductive regulatory factors and ovarian energy metabolism is unclear. Article Title: Discovery and characterization of Vibrio parahaemolyticus AHPND-responsive piRNAs in modulating shrimp immune response. Article Snippet: 31 Piwi-interacting RNAs (piRNAs) represent the largest class of small non-coding RNAs, 32 typically ranging from 24-31 nucleotides in length.. When complexed with PIWI protein, 33 piRNAs suppress expression of transposons and protein-coding genes, acting at both the 34 transcriptional or post-transcriptional levels.. While a recent study suggest that piRNAs play a 35 regulatory role in shrimp during viral infections, their involvement in antibacterial responses 36 remains unexplored. Article Title: CHD7 binds distinct regions in the Sox11 locus to regulate neuronal differentiation Article Snippet: .. 5’ GCACTCGAGTCTGTGAACTAGG 3’ ( Sox11 sense), 5’ GCGTTGTGTGCATAGCAGTC 3’ ( Sox11 antisense), 5’ CCAGGACAATGGCACTGAAT 3’ ( Hmbs sense), 5’ AAAGTTCCCCAACCTGGAAT 3’ ( Hmbs antisense) primers were used in individual reactions for Article Title: Andrographolide Suppresses Influenza A Virus-Induced Pyroptosis via PI3K/AKT-Mediated Caspase-3/GSDME Inactivation. Article Snippet: Subsequently, RNA-seq libraries were prepared specifically from high-integrity RNA that passed quality assessments, which is a critical step for reliable transcriptomic profiling (RNA Integrity Number > 7.0) by Annoroad Gene Technology Co., Ltd. (Beijing, China). .. Briefly, after Article Title: Discovery of functional factorless internal ribosome entry site-like structures through virome mining Article Snippet: .. RT Primer extension of modified and control RNAs was performed with primer 5’ -GTGTTGTTGTTTTGTTGTTTTCGTTG-3’ using Superscript III Reverse Transcriptase (SSIII, Thermo Fisher Scientific), with Mn2 + ; followed by second Article Title: CapTrap-seq: Advancing zebrafish transcriptomic research through high-fidelity full-length RNA sequencing Article Snippet: Samples were quantified with Qubit (Thermo Fisher Scientific). .. 4 μl of ribo-depleted RNA per reaction was used for Article Title: Mucus-derived glycans are inhibitory signals for Salmonella Typhimurium SPI-1-mediated invasion. Article Snippet: .. Reverse transcription was performed by Reverse Transcription:Article Title: Gonadotropin-Inhibitory Hormone (GnIH) Induces Glycolipid Metabolic Dysfunction in Porcine Ovarian Granulosa Cells via Wnt and AMPK Signaling Pathways. Article Snippet: Animal reproduction is closely linked to energy metabolism, and ovarian glycolipid metabolism disorders can lead to follicular abnormalities, reduced fertility, and infertility.. Granulosa cells (GCs), as key energy suppliers in the ovary, directly influence oocyte development, hormone secretion, and reproductive function.. However, the interaction between reproductive regulatory factors and ovarian energy metabolism is unclear. Article Title: CHD7 binds distinct regions in the Sox11 locus to regulate neuronal differentiation Article Snippet: .. 5’ GCACTCGAGTCTGTGAACTAGG 3’ ( Sox11 sense), 5’ GCGTTGTGTGCATAGCAGTC 3’ ( Sox11 antisense), 5’ CCAGGACAATGGCACTGAAT 3’ ( Hmbs sense), 5’ AAAGTTCCCCAACCTGGAAT 3’ ( Hmbs antisense) primers were used in individual reactions for Article Title: Discovery of functional factorless internal ribosome entry site-like structures through virome mining Article Snippet: .. RT Primer extension of modified and control RNAs was performed with primer 5’ -GTGTTGTTGTTTTGTTGTTTTCGTTG-3’ using Superscript III Reverse Transcriptase (SSIII, Thermo Fisher Scientific), with Mn2 + ; followed by second Article Title: Mucus-derived glycans are inhibitory signals for Salmonella Typhimurium SPI-1-mediated invasion. Article Snippet: .. Reverse transcription was performed by other:Article Title: Discovery of functional factorless internal ribosome entry site-like structures through virome mining. Article Snippet: PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1013255 June 26, 2025 22 / 30 In vitro translation assays In vitro transcribed RNAs were incubated in rabbit reticulocyte lysates (RRL) or Sf21 insect lysates (Promega) for 1 hour at 37C or 30C in the presence of [35S]-methionine as described previously [78]. RNA Extraction:Article Title: Discovery and characterization of Vibrio parahaemolyticus AHPND-responsive piRNAs in modulating shrimp immune response. Article Snippet: 31 Piwi-interacting RNAs (piRNAs) represent the largest class of small non-coding RNAs, 32 typically ranging from 24-31 nucleotides in length.. When complexed with PIWI protein, 33 piRNAs suppress expression of transposons and protein-coding genes, acting at both the 34 transcriptional or post-transcriptional levels.. While a recent study suggest that piRNAs play a 35 regulatory role in shrimp during viral infections, their involvement in antibacterial responses 36 remains unexplored. Quantitative RT-PCR:Article Title: Discovery and characterization of Vibrio parahaemolyticus AHPND-responsive piRNAs in modulating shrimp immune response. Article Snippet: 31 Piwi-interacting RNAs (piRNAs) represent the largest class of small non-coding RNAs, 32 typically ranging from 24-31 nucleotides in length.. When complexed with PIWI protein, 33 piRNAs suppress expression of transposons and protein-coding genes, acting at both the 34 transcriptional or post-transcriptional levels.. While a recent study suggest that piRNAs play a 35 regulatory role in shrimp during viral infections, their involvement in antibacterial responses 36 remains unexplored. Article Title: Mucus-derived glycans are inhibitory signals for Salmonella Typhimurium SPI-1-mediated invasion. Article Snippet: .. Reverse transcription was performed by Real-time Polymerase Chain Reaction:Article Title: Discovery and characterization of Vibrio parahaemolyticus AHPND-responsive piRNAs in modulating shrimp immune response. Article Snippet: 31 Piwi-interacting RNAs (piRNAs) represent the largest class of small non-coding RNAs, 32 typically ranging from 24-31 nucleotides in length.. When complexed with PIWI protein, 33 piRNAs suppress expression of transposons and protein-coding genes, acting at both the 34 transcriptional or post-transcriptional levels.. While a recent study suggest that piRNAs play a 35 regulatory role in shrimp during viral infections, their involvement in antibacterial responses 36 remains unexplored. Article Title: Mucus-derived glycans are inhibitory signals for Salmonella Typhimurium SPI-1-mediated invasion. Article Snippet: .. Reverse transcription was performed by Construct:Article Title: Andrographolide Suppresses Influenza A Virus-Induced Pyroptosis via PI3K/AKT-Mediated Caspase-3/GSDME Inactivation. Article Snippet: Subsequently, RNA-seq libraries were prepared specifically from high-integrity RNA that passed quality assessments, which is a critical step for reliable transcriptomic profiling (RNA Integrity Number > 7.0) by Annoroad Gene Technology Co., Ltd. (Beijing, China). .. Briefly, after Amplification:Article Title: Andrographolide Suppresses Influenza A Virus-Induced Pyroptosis via PI3K/AKT-Mediated Caspase-3/GSDME Inactivation. Article Snippet: Subsequently, RNA-seq libraries were prepared specifically from high-integrity RNA that passed quality assessments, which is a critical step for reliable transcriptomic profiling (RNA Integrity Number > 7.0) by Annoroad Gene Technology Co., Ltd. (Beijing, China). .. Briefly, after Polymerase Chain Reaction:Article Title: Andrographolide Suppresses Influenza A Virus-Induced Pyroptosis via PI3K/AKT-Mediated Caspase-3/GSDME Inactivation. Article Snippet: Subsequently, RNA-seq libraries were prepared specifically from high-integrity RNA that passed quality assessments, which is a critical step for reliable transcriptomic profiling (RNA Integrity Number > 7.0) by Annoroad Gene Technology Co., Ltd. (Beijing, China). .. Briefly, after Modification:Article Title: Discovery of functional factorless internal ribosome entry site-like structures through virome mining Article Snippet: .. RT Primer extension of modified and control RNAs was performed with primer 5’ -GTGTTGTTGTTTTGTTGTTTTCGTTG-3’ using Superscript III Reverse Transcriptase (SSIII, Thermo Fisher Scientific), with Mn2 + ; followed by second Control:Article Title: Discovery of functional factorless internal ribosome entry site-like structures through virome mining Article Snippet: .. RT Primer extension of modified and control RNAs was performed with primer 5’ -GTGTTGTTGTTTTGTTGTTTTCGTTG-3’ using Superscript III Reverse Transcriptase (SSIII, Thermo Fisher Scientific), with Mn2 + ; followed by second |